CellMiner - Datasets

Data Set Metadata

Provides background information about each data set. Check back for additional data sets as we make them available.

Name	Platform Information	Principal Collaborators	Data Description
DNA
DNA: Sequencing [citation]	Manufacturer: ABI 3730 Sequencer Platform: Sequencing Molecular Target: DNA Platform Description: Sequencing of the NCI-60 for mutations in known human cancer genes. The coding exons and immediate flanking intron sequences of selected genes from the Cancer Gene Census were PCR-amplified and sequenced.	Wellcome Trust Sanger Institute (M Stratton); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: NA Base-calling method: Mutation surveyor, Chromas, in-house Sanger software Cell Lines: NCI-60
DNA: BAC aCGH [citation]	Manufacturer: University of California San Francisco Platform: BAC Clone arrays Molecular Target: DNA Platform Description: DNA samples from tumor cells and from normal controls were labeled with CY3 and CY5, respectively and hybridized to array comprised of 353 unique loci on the bacterial artificial chromosome microarray	UCSF Comp Cancer Ctr(J Gray); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: ratio of sample vs control of DNA copy number Normalization method: Cell Lines: NCI-60
DNA: E-cadherin Methylation [citation]	Manufacturer: NA Platform: PCR amplification and sequencing of sodium bisulfite modified DNA. Molecular Target: DNA methylation Platform Description: Genomic DNA (5 micrograms) from each cell line was treated with sodium bisulfite at 50 degrees C for 17 hr using the CpGenome DNA Modification kit from (Chemicon International, Temecula, CA) according to manufacturer's instructions. The DNA was then re-suspended in 125 microliters of 10-mM Tris with 1 mM EDTA pH 7.4 (KD Medical, Columbia, MD). Nested PCR amplification and sequencing of the DNA were carried out using either converted or unconverted DNA as template for the PCR. Primers were based on the E-cad promoter DNA sequence (GenBank accession no. L34545). Two pairs of primers were used. For the bisulfite-converted DNA, the first pair, which amplified a 413-bp deaminated DNA fragment, consisted GATTTTAGGTTTTAGTGAGTT upstream (sequence position -397 to -377) and E-cad-nest2/4 GGAAACAGCTATGACCATGAA CTCCAAAAACCCATAACTAA downstream (sequence position -6 to +16). The second pair was GTAAAACGACGGCCAGTTATTTAGATTTTAGTAATTTT (upstream, sequence position -319 to -299) and inner primers (with 5' m13 tails) were used to amplify a smaller (335 nucleotide) but higher-quality product. For the unconverted DNA, the same locations of primers were used, with GATCCC AGGTCTTAGTGAGCC, GGAAACAGCTATGACCATGTTCTCCAAGGGCCCATG GCTAA, and GTAAAACGACGGCCAGCCACCTAGACCCTAGCAACTCC. One-strand automated sequencing of the PCR products was performed.	Gene Logic (D Dolginow), SAIC (D Munroe), Johns Hopkins Univ. (A Feinberg); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: sequence tracings Normalization method: Multiple sequence tracings were grouped by bisulfite conversion and sequencing date, calculated as a group mean for each CpG within these groups, and then combined as a mean of these groups. Cell Lines: NCI-60
RNA
RNA: Affy HU6800 [citation]	Manufacturer: Affymetrix Platform: HU6800 Molecular Target: RNA Platform Description: 6,800 probe set array	Whitehead (Broad) (E Lander, T Golub); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: cel files Normalization method: GCRMA, MAS5, RMA Cell Lines: NCI-60
RNA: cDNA Array [citation]	Manufacturer: Synteni, now Incyte, Inc. Platform: cDNA array Molecular Target: RNA Platform Description: 9,700 clone two-color flourescence	Stanford (P Brown, D Botstein); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: Two channel sample and pool intensity values. Normalization method: Log2 ratio of sample vs control using Gaussian kernel moving-average Cell Lines: NCI-60
RNA: miRNA OSU V3 chip [citation]	Manufacturer: Ohio State University Comprehensive Cancer Center Platform: OSU-CCC_hsa-miRNA-chip_v3 For array design, see: V3 design protocol A-MEXP-620 published on ArrayExpress (www.ebi.ac.uk/arrayexpress/) Molecular Target: RNA Platform Description: See: Liu CG, Calin GA, Meloon B, Gamliel N, Sevignani C, Ferracin M, Dumitru CD, Shimizu M, Zupo S, Dono M, Alder H, Bullrich F, Negrini M, and Croce CM. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc Natl Acad Sci U S A 2004;101:9740-4.	CCC, OSU (P Blower); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: Two channel sample and background intensity measurements. Normalization method: From the Genepix data, we selected human probes (entries with ID=hsa-[anything]) and median signal intensity minus background for each spot (column labeled 'F635 Median - B635'). After converting any negative values to 1, signal intensities were log2-transformed, and duplicate spots were averaged. Then we performed quantile normalization across the 3 microarray batches, replaced all values less than 5 with the median of such values, and set the value for each control cell line to the mean of its five replicates. Cell Lines: NCI-60
RNA: Oncochip [citation]	Manufacturer: NCI Advanced Technology Cen Platform: Oncochip Molecular Target: RNA Platform Description: The Oncochip is a pin-spotted cDNA microarray developed in the Microarray Facility, Advanced Technology Center, National Cancer Institute, NIH, and prepared by Willam C. Reinhold. This glass slide microarray contains 2208 cDNA spots corresponding to 1648 individual human cancer-interesting genes (array lot HS-OC-2p10-101899). Included were 780 spots representing 364 individual genes in replicate.	ATC, CCR, NCI (E Liu); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: Two channel sample and background intensity measurements. Normalization method: Gaussian-kernel fitting method to genrate ratio and fold change values of sample vs control Cell Lines: DU-145/RC-01
RNA: Transporter Array [citation]	Manufacturer: Ohio State University Platform: Spotted Array Molecular Target: RNA Platform Description: Spotted 70-mer microarray	OSU (W Sadee); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: Normalization method: Normalization based on robust, locally linear fits (Loess), implemented in the SMA R package Cell Lines: NCI-60
RNA: Affy HG-U133(A,B) [citation]	Manufacturer: Affymetrix Platform: Human Genome U133 Molecular Target: RNA Platform Description: 44,000 probeset 2-chip set	Gene Logic (U Scherf, E Kaljian); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: cel files Normalization method: GCRMA, MAS5, RMA Cell Lines: NCI-60,DU-145/RC-01 59 cell lines - LC:NCI_H23 is excluded
RNA: Affy HG-U95(A-E) [citation]	Manufacturer: Affymetrix Platform: Human Genome U95 Molecular Target: RNA Platform Description: 65,000 probeset 5-chip set	Gene Logic (U Scherf, D Dolginow); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: cel files Normalization method: GCRMA, MAS5, RMA Cell Lines: NCI-60,DU-145/RC-01
Protein
Protein: Lysate Array [citation]	Manufacturer: NCI LMP Genomics and Bioinformatics Group (Nishizuka) Platform: Reverse-phase lysate arrays (RPLA) Molecular Target: Protein Platform Description: Reverse-phase lysate arrays (RPLA) for 176 antibodies. Each array included 64 lysates (60 cancer cells and 4 replicate control pools) in 10 serial two-fold dilutions.	LP, CCR, NCI (L Liotta); CBER, FDA (E Petricoin); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: Signal intensity processed by DI25 algorithm (log2) Normalization method: DI25 optimization Cell Lines: NCI-60
Drug
Drug: A118 [citation]	Manufacturer: Developmental Therapeutics Program, NCI/NIH Platform: Sulforhodamine assay Molecular Target: Platform Description: Negative log10(Gi50) values of Sulforhodamine assay for 118 molecules (also known as the Standard Agents) with known 2D structure, known mechanism of action and have been tested at-least 4 times. Higher values equate to higher sensitivity of cell lines.	LMP, CCR, NCI (K Kohn); DPT, NCI (D Zaharevitz); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: Normalization method: Cell Lines: NCI-60
Drug: A1429 [citation]	Manufacturer: Developmental Therapeutics Program, NCI/NIH Platform: Sulforhodamine assay Molecular Target: Platform Description: Negative log10(Gi50) values of Sulforhodamine assay for 1429 molecules (also known as the Standard Agents) with known 2D structure, known mechanism of action for many of the drugs and have been tested at-least 4 times. Higher values equate to higher sensitivity of cell lines.	DPT, NCI (D Zaharevitz, S Bates); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: Normalization method: Cell Lines: NCI-60
Drug: A4463 [citation]	Manufacturer: Developmental Therapeutics Program, NCI/NIH Platform: Sulforhodamine assay Molecular Target: Platform Description: Negative log10(Gi50) values of Sulforhodamine assay for 4463 molecules (also known as the Standard Agents) with known 2D structure and have been tested at-least 2 times. Higher values equate to higher sensitivity of cell lines.	DPT, NCI (D Zaharevitz, S Bates); Genomics and Bioinf Gp, LMP, CCR, NCI	Raw Data: Normalization method: Cell Lines: NCI-60

Go to top

If you would like to receive the latest news about CellMiner, and the other tools and content provided by the NCI/LMP Genomics and Bioinformatics group, sign up for our announcements mailing list.