Provides background information about each data set. Check back for additional
data sets as we make them available.
| Name |
Platform Information |
Principal Collaborators |
Data Description |
| DNA |
DNA: Sequencing
[citation] |
Manufacturer: ABI 3730 Sequencer
Platform: Sequencing
Molecular Target: DNA
Platform Description: Sequencing of the NCI-60 for mutations in known human cancer genes. The coding exons and immediate flanking intron sequences of selected genes from the Cancer Gene Census were PCR-amplified and sequenced. |
Wellcome Trust Sanger Institute (M Stratton); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: NA
Base-calling method: Mutation surveyor, Chromas, in-house Sanger software
Cell Lines: NCI-60
|
DNA: BAC aCGH
[citation] |
Manufacturer: University of California San Francisco
Platform: BAC Clone arrays
Molecular Target: DNA
Platform Description: DNA samples from tumor cells and from normal controls were labeled with CY3 and CY5, respectively and hybridized to array comprised of 353 unique loci on the bacterial artificial chromosome microarray |
UCSF Comp Cancer Ctr(J Gray); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: ratio of sample vs control of DNA copy number
Normalization method:
Cell Lines: NCI-60
|
DNA: E-cadherin Methylation
[citation] |
Manufacturer: NA
Platform: PCR amplification and sequencing of sodium bisulfite modified DNA.
Molecular Target: DNA methylation
Platform Description: Genomic DNA (5 micrograms) from each cell line was treated with sodium bisulfite at 50 degrees C for 17 hr using the CpGenome DNA Modification kit from (Chemicon International, Temecula, CA) according to manufacturer's instructions. The DNA was then re-suspended in 125 microliters of 10-mM Tris with 1 mM EDTA pH 7.4 (KD Medical, Columbia, MD). Nested PCR amplification and sequencing of the DNA were carried out using either converted or unconverted DNA as template for the PCR. Primers were based on the E-cad promoter DNA sequence (GenBank accession no. L34545). Two pairs of primers were used. For the bisulfite-converted DNA, the first pair, which amplified a 413-bp deaminated DNA fragment, consisted GATTTTAGGTTTTAGTGAGTT upstream (sequence position -397 to -377) and E-cad-nest2/4 GGAAACAGCTATGACCATGAA CTCCAAAAACCCATAACTAA downstream (sequence position -6 to +16). The second pair was GTAAAACGACGGCCAGTTATTTAGATTTTAGTAATTTT (upstream, sequence position -319 to -299) and inner primers (with 5' m13 tails) were used to amplify a smaller (335 nucleotide) but higher-quality product. For the unconverted DNA, the same locations of primers were used, with GATCCC AGGTCTTAGTGAGCC, GGAAACAGCTATGACCATGTTCTCCAAGGGCCCATG GCTAA, and GTAAAACGACGGCCAGCCACCTAGACCCTAGCAACTCC. One-strand automated sequencing of the PCR products was performed. |
Gene Logic (D Dolginow), SAIC (D Munroe), Johns Hopkins Univ. (A Feinberg); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: sequence tracings
Normalization method: Multiple sequence tracings were grouped by bisulfite conversion and sequencing date, calculated as a group mean for each CpG within these groups, and then combined as a mean of these groups.
Cell Lines: NCI-60
|
| RNA |
RNA: Affy HU6800
[citation] |
Manufacturer: Affymetrix
Platform: HU6800
Molecular Target: RNA
Platform Description: 6,800 probe set array |
Whitehead (Broad) (E Lander, T Golub); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: cel files
Normalization method: GCRMA, MAS5, RMA
Cell Lines: NCI-60
|
RNA: cDNA Array
[citation] |
Manufacturer: Synteni, now Incyte, Inc.
Platform: cDNA array
Molecular Target: RNA
Platform Description: 9,700 clone two-color flourescence |
Stanford (P Brown, D Botstein); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: Two channel sample and pool intensity values.
Normalization method: Log2 ratio of sample vs control using Gaussian kernel moving-average
Cell Lines: NCI-60
|
RNA: miRNA OSU V3 chip
[citation] |
Manufacturer: Ohio State University Comprehensive Cancer Center
Platform: OSU-CCC_hsa-miRNA-chip_v3 For array design, see: V3 design protocol A-MEXP-620 published on ArrayExpress (www.ebi.ac.uk/arrayexpress/)
Molecular Target: RNA
Platform Description: See: Liu CG, Calin GA, Meloon B, Gamliel N, Sevignani C, Ferracin M, Dumitru CD, Shimizu M, Zupo S, Dono M, Alder H, Bullrich F, Negrini M, and Croce CM. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc Natl Acad Sci U S A 2004;101:9740-4. |
CCC, OSU (P Blower); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: Two channel sample and background intensity measurements.
Normalization method: From the Genepix data, we selected human probes (entries with ID=hsa-[anything]) and median signal intensity minus background for each spot (column labeled 'F635 Median - B635'). After converting any negative values to 1, signal intensities were log2-transformed, and duplicate spots were averaged. Then we performed quantile normalization across the 3 microarray batches, replaced all values less than 5 with the median of such values, and set the value for each control cell line to the mean of its five replicates.
Cell Lines: NCI-60
|
RNA: Oncochip
[citation] |
Manufacturer: NCI Advanced Technology Cen
Platform: Oncochip
Molecular Target: RNA
Platform Description: The Oncochip is a pin-spotted cDNA microarray developed in the Microarray Facility, Advanced Technology Center, National Cancer Institute, NIH, and prepared by Willam C. Reinhold. This glass slide microarray contains 2208 cDNA spots corresponding to 1648 individual human cancer-interesting genes (array lot HS-OC-2p10-101899). Included were 780 spots representing 364 individual genes in replicate. |
ATC, CCR, NCI (E Liu); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: Two channel sample and background intensity measurements.
Normalization method: Gaussian-kernel fitting method to genrate ratio and fold change values of sample vs control
Cell Lines: DU-145/RC-01
|
RNA: Transporter Array
[citation] |
Manufacturer: Ohio State University
Platform: Spotted Array
Molecular Target: RNA
Platform Description: Spotted 70-mer microarray |
OSU (W Sadee); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data:
Normalization method: Normalization based on robust, locally linear fits (Loess), implemented in the SMA R package
Cell Lines: NCI-60
|
RNA: Affy HG-U133(A,B)
[citation] |
Manufacturer: Affymetrix
Platform: Human Genome U133
Molecular Target: RNA
Platform Description: 44,000 probeset 2-chip set |
Gene Logic (U Scherf, E Kaljian); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: cel files
Normalization method: GCRMA, MAS5, RMA
Cell Lines: NCI-60,DU-145/RC-01
59 cell lines - LC:NCI_H23 is excluded |
RNA: Affy HG-U95(A-E)
[citation] |
Manufacturer: Affymetrix
Platform: Human Genome U95
Molecular Target: RNA
Platform Description: 65,000 probeset 5-chip set |
Gene Logic (U Scherf, D Dolginow); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: cel files
Normalization method: GCRMA, MAS5, RMA
Cell Lines: NCI-60,DU-145/RC-01
|
| Protein |
Protein: Lysate Array
[citation] |
Manufacturer: NCI LMP Genomics and Bioinformatics Group (Nishizuka)
Platform: Reverse-phase lysate arrays (RPLA)
Molecular Target: Protein
Platform Description: Reverse-phase lysate arrays (RPLA) for 176 antibodies. Each array included 64 lysates (60 cancer cells and 4 replicate control pools) in 10 serial two-fold dilutions. |
LP, CCR, NCI (L Liotta); CBER, FDA (E Petricoin); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data: Signal intensity processed by DI25 algorithm (log2)
Normalization method: DI25 optimization
Cell Lines: NCI-60
|
| Drug |
Drug: A118
[citation] |
Manufacturer: Developmental Therapeutics Program, NCI/NIH
Platform: Sulforhodamine assay
Molecular Target:
Platform Description: Negative log10(Gi50) values of Sulforhodamine assay for 118 molecules (also known as the Standard Agents) with known 2D structure, known mechanism of action and have been tested at-least 4 times. Higher values equate to higher sensitivity of cell lines. |
LMP, CCR, NCI (K Kohn); DPT, NCI (D Zaharevitz); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data:
Normalization method:
Cell Lines: NCI-60
|
Drug: A1429
[citation] |
Manufacturer: Developmental Therapeutics Program, NCI/NIH
Platform: Sulforhodamine assay
Molecular Target:
Platform Description: Negative log10(Gi50) values of Sulforhodamine assay for 1429 molecules (also known as the Standard Agents) with known 2D structure, known mechanism of action for many of the drugs and have been tested at-least 4 times. Higher values equate to higher sensitivity of cell lines. |
DPT, NCI (D Zaharevitz, S Bates); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data:
Normalization method:
Cell Lines: NCI-60
|
Drug: A4463
[citation] |
Manufacturer: Developmental Therapeutics Program, NCI/NIH
Platform: Sulforhodamine assay
Molecular Target:
Platform Description: Negative log10(Gi50) values of Sulforhodamine assay for 4463 molecules (also known as the Standard Agents) with known 2D structure and have been tested at-least 2 times. Higher values equate to higher sensitivity of cell lines. |
DPT, NCI (D Zaharevitz, S Bates); Genomics and Bioinf Gp, LMP, CCR, NCI |
Raw Data:
Normalization method:
Cell Lines: NCI-60
|